ID: 1135554507_1135554511

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1135554507 1135554511
Species Human (GRCh38) Human (GRCh38)
Location 16:23424830-23424852 16:23424845-23424867
Sequence CCTGCTCGGGCCCTGCCCTCTCC CCCTCTCCACGCCGTTGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 93, 4: 871} {0: 1, 1: 0, 2: 0, 3: 5, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!