ID: 1135607343_1135607349

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1135607343 1135607349
Species Human (GRCh38) Human (GRCh38)
Location 16:23836062-23836084 16:23836087-23836109
Sequence CCGCGGCCCCGGGTGCAGCAGCG CGCCGCCTCCCGCGCCTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 234} {0: 1, 1: 0, 2: 13, 3: 77, 4: 776}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!