ID: 1135607345_1135607355

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1135607345 1135607355
Species Human (GRCh38) Human (GRCh38)
Location 16:23836068-23836090 16:23836101-23836123
Sequence CCCCGGGTGCAGCAGCGGCCGCC CCTCCCCGGCCCGCAGCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 361} {0: 1, 1: 0, 2: 2, 3: 56, 4: 499}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!