ID: 1135607348_1135607363

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1135607348 1135607363
Species Human (GRCh38) Human (GRCh38)
Location 16:23836086-23836108 16:23836116-23836138
Sequence CCGCCGCCTCCCGCGCCTCCCCG GCCCGCGGTCCCGCGGCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 231, 4: 1670} {0: 1, 1: 0, 2: 4, 3: 34, 4: 329}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!