ID: 1135607360_1135607372

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1135607360 1135607372
Species Human (GRCh38) Human (GRCh38)
Location 16:23836110-23836132 16:23836132-23836154
Sequence CCCGCAGCCCGCGGTCCCGCGGC CCCCGGGGCCGGCACCTCTCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 32, 4: 247} {0: 1, 1: 0, 2: 1, 3: 17, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!