ID: 1135607364_1135607383

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1135607364 1135607383
Species Human (GRCh38) Human (GRCh38)
Location 16:23836117-23836139 16:23836166-23836188
Sequence CCCGCGGTCCCGCGGCCCCGGGG CGCGCGCAAGATGGCTGACCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 285} {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!