ID: 1135864675_1135864685

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1135864675 1135864685
Species Human (GRCh38) Human (GRCh38)
Location 16:26090445-26090467 16:26090496-26090518
Sequence CCTTCCTAGAGGATCATCCATTC GGGTGCACAAAATTTCCCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 108} {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!