ID: 1135864682_1135864685

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1135864682 1135864685
Species Human (GRCh38) Human (GRCh38)
Location 16:26090476-26090498 16:26090496-26090518
Sequence CCTGCAGAGGGGCATGAAAAGGG GGGTGCACAAAATTTCCCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 220} {0: 1, 1: 0, 2: 0, 3: 4, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!