ID: 1135933560_1135933569

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1135933560 1135933569
Species Human (GRCh38) Human (GRCh38)
Location 16:26760047-26760069 16:26760083-26760105
Sequence CCGCACCTTCCACCTCATGCCAA AATTCAGGGACTGTGCAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 38, 4: 461} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!