ID: 1135940320_1135940330

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1135940320 1135940330
Species Human (GRCh38) Human (GRCh38)
Location 16:26816733-26816755 16:26816777-26816799
Sequence CCTCTCCCTCTGTCCATCCTGGG CCTCGAGTGACTACCTGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 67, 4: 641} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!