ID: 1135983338_1135983341

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1135983338 1135983341
Species Human (GRCh38) Human (GRCh38)
Location 16:27165825-27165847 16:27165845-27165867
Sequence CCAGGGTGAGACCAAGGAGGTGC TGCCCAGAATGGAAAATTTAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 26, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!