ID: 1136081783_1136081790

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1136081783 1136081790
Species Human (GRCh38) Human (GRCh38)
Location 16:27856981-27857003 16:27857015-27857037
Sequence CCCAGCTTTCTTCCAGCCTGGCA TCTCTTCGATTGGGCACCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 294} {0: 1, 1: 0, 2: 0, 3: 9, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!