ID: 1136118492_1136118502

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1136118492 1136118502
Species Human (GRCh38) Human (GRCh38)
Location 16:28112087-28112109 16:28112119-28112141
Sequence CCGCTGGCTGCACACCTGGAACC AGGCTCGTTTCTTGCAACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 235} {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!