ID: 1136146706_1136146719

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1136146706 1136146719
Species Human (GRCh38) Human (GRCh38)
Location 16:28320615-28320637 16:28320647-28320669
Sequence CCGGCCCTCGCACCGCGCGCGCA GGGACCGCCCGCCCGCCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 145} {0: 1, 1: 0, 2: 1, 3: 38, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!