ID: 1136253419_1136253427

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1136253419 1136253427
Species Human (GRCh38) Human (GRCh38)
Location 16:29022579-29022601 16:29022623-29022645
Sequence CCGTATTTTCCCCACTCATCTGA AAATTCTCTTGGGCTGTTTCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!