ID: 1136414850_1136414860

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1136414850 1136414860
Species Human (GRCh38) Human (GRCh38)
Location 16:30096597-30096619 16:30096615-30096637
Sequence CCCGTTGGCTCCACTGTACCGGG CCGGGGGCTGAGGCCCAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 58} {0: 1, 1: 0, 2: 10, 3: 80, 4: 834}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!