ID: 1136414856_1136414869

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1136414856 1136414869
Species Human (GRCh38) Human (GRCh38)
Location 16:30096607-30096629 16:30096660-30096682
Sequence CCACTGTACCGGGGGCTGAGGCC CAGCTAGTAAGAGGCGAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 706} {0: 1, 1: 0, 2: 40, 3: 246, 4: 1176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!