ID: 1136414862_1136414867

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1136414862 1136414867
Species Human (GRCh38) Human (GRCh38)
Location 16:30096628-30096650 16:30096651-30096673
Sequence CCCAGGGAGGTCTCGCGGCTCCC TAGGTTATCCAGCTAGTAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115} {0: 1, 1: 1, 2: 29, 3: 168, 4: 867}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!