ID: 1136504426_1136504446

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1136504426 1136504446
Species Human (GRCh38) Human (GRCh38)
Location 16:30693887-30693909 16:30693937-30693959
Sequence CCTTAGCAGCCCCACCAATTGAT AGAGGGAGAAGGAAAGGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 103} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!