ID: 1136515551_1136515556

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1136515551 1136515556
Species Human (GRCh38) Human (GRCh38)
Location 16:30766144-30766166 16:30766168-30766190
Sequence CCTGCCTCCCACTCCTTAGTTTG GATGCTGAATGCAGAGTTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 255} {0: 1, 1: 0, 2: 0, 3: 16, 4: 530}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!