ID: 1136521070_1136521072

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1136521070 1136521072
Species Human (GRCh38) Human (GRCh38)
Location 16:30796180-30796202 16:30796213-30796235
Sequence CCAAGATCACACTCACTGCAGCA TCGCCCAAGCTGGATTGCAGTGG
Strand - +
Off-target summary No data {0: 11, 1: 1738, 2: 74826, 3: 237505, 4: 248929}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!