ID: 1136791043_1136791052

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1136791043 1136791052
Species Human (GRCh38) Human (GRCh38)
Location 16:32968421-32968443 16:32968455-32968477
Sequence CCAAAGGGAAAGAAAGATGCAAA TTCCCCCGAGCGGTTGGGGCAGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 2, 3: 4, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!