ID: 1136908089_1136908094

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1136908089 1136908094
Species Human (GRCh38) Human (GRCh38)
Location 16:34120469-34120491 16:34120513-34120535
Sequence CCGGCAGTTGAGGACCATGTGGA TCCCAACCTGAGAGCAGAACAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 2, 3: 14, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!