ID: 1137023289_1137023298

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1137023289 1137023298
Species Human (GRCh38) Human (GRCh38)
Location 16:35451313-35451335 16:35451362-35451384
Sequence CCAGAGACTAGGAGACCCAAACT GAATCCAAAGTGGCTGGTGGCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!