ID: 1137286549_1137286556

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1137286549 1137286556
Species Human (GRCh38) Human (GRCh38)
Location 16:47020879-47020901 16:47020917-47020939
Sequence CCAGGCTGGTCTTGAACTCCTGA CCTTGGCTTCCCAAAGTGCTGGG
Strand - +
Off-target summary {0: 50001, 1: 120441, 2: 170670, 3: 194372, 4: 129314} {0: 4470, 1: 94554, 2: 217476, 3: 235975, 4: 145895}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!