ID: 1137286552_1137286554

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1137286552 1137286554
Species Human (GRCh38) Human (GRCh38)
Location 16:47020902-47020924 16:47020916-47020938
Sequence CCTCATGATCCATCGCCTTGGCT GCCTTGGCTTCCCAAAGTGCTGG
Strand - +
Off-target summary No data {0: 2598, 1: 60586, 2: 173311, 3: 219593, 4: 172089}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!