ID: 1137593172_1137593178

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1137593172 1137593178
Species Human (GRCh38) Human (GRCh38)
Location 16:49706352-49706374 16:49706379-49706401
Sequence CCAGGCCAGCCATGGCCACAGCT GGCCAATCAGACAGACACGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 60, 4: 433} {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!