ID: 1137748529_1137748536

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1137748529 1137748536
Species Human (GRCh38) Human (GRCh38)
Location 16:50841380-50841402 16:50841431-50841453
Sequence CCGTGGGGGCCGCCTCCGCTGTA TTTGTTTTCAAAATGACACGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!