ID: 1138105385_1138105392

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1138105385 1138105392
Species Human (GRCh38) Human (GRCh38)
Location 16:54284923-54284945 16:54284953-54284975
Sequence CCACGGCCACTGGTGGTGGCGCT GACTCAGGACCGGTAGTGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 123} {0: 1, 1: 0, 2: 0, 3: 2, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!