ID: 1138189558_1138189563

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1138189558 1138189563
Species Human (GRCh38) Human (GRCh38)
Location 16:55003406-55003428 16:55003439-55003461
Sequence CCAGCTGGCAATGCTCAGTGGAC TTGTATGACAAACACCTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107} {0: 1, 1: 0, 2: 0, 3: 7, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!