ID: 1138230239_1138230249 |
View in Genome Browser |
Spacer: 17 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1138230239 | 1138230249 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 16:55331206-55331228 | 16:55331246-55331268 |
Sequence | CCGGTACAGGCCAACCAATGGGA | GGGTCTTTGTCCCCCTTGCTAGG |
Strand | - | + |
Off-target summary | No data | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |