ID: 1138425538_1138425546

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1138425538 1138425546
Species Human (GRCh38) Human (GRCh38)
Location 16:56929743-56929765 16:56929794-56929816
Sequence CCATTTTGGCTGCTGTCACTGCA TTGCAATAGGCCAGGCATGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 12, 2: 152, 3: 1164, 4: 6214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!