ID: 1138427521_1138427526

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1138427521 1138427526
Species Human (GRCh38) Human (GRCh38)
Location 16:56945970-56945992 16:56945997-56946019
Sequence CCTTTAATATGCCTGAAGCTGGG TCCCTTCCTGAGAATGGCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 20, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!