ID: 1138496984_1138496995

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1138496984 1138496995
Species Human (GRCh38) Human (GRCh38)
Location 16:57415014-57415036 16:57415065-57415087
Sequence CCCAGAGGTCCCCGCAACACACA GCTCCTCTCCCTGCAGCTCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 111} {0: 1, 1: 0, 2: 3, 3: 44, 4: 380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!