ID: 1138670463_1138670471

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1138670463 1138670471
Species Human (GRCh38) Human (GRCh38)
Location 16:58610274-58610296 16:58610320-58610342
Sequence CCAGGCATGGTGGTAGACACCTG GCTTAAACGCAGGAGGTGGAGGG
Strand - +
Off-target summary {0: 15, 1: 832, 2: 12470, 3: 48626, 4: 117736} {0: 1, 1: 2, 2: 158, 3: 545, 4: 1399}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!