|
Left Crispr |
Right Crispr |
Crispr ID |
1138670464 |
1138670471 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:58610293-58610315
|
16:58610320-58610342
|
Sequence |
CCTGTAATCCCAGCTACTCAGAG |
GCTTAAACGCAGGAGGTGGAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 348, 1: 4384, 2: 66014, 3: 156492, 4: 239406} |
{0: 1, 1: 2, 2: 158, 3: 545, 4: 1399} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|