ID: 1138699485_1138699493

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1138699485 1138699493
Species Human (GRCh38) Human (GRCh38)
Location 16:58846984-58847006 16:58847020-58847042
Sequence CCGAGATGGCAGCAGCACAGTCC CATGAGAGGGAGACCGTGGAGGG
Strand - +
Off-target summary {0: 73, 1: 841, 2: 430, 3: 172, 4: 1041} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!