ID: 1138884904_1138884910

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1138884904 1138884910
Species Human (GRCh38) Human (GRCh38)
Location 16:61064866-61064888 16:61064900-61064922
Sequence CCCAAATGCCCATAATGATGGAC AATGTGGCTCATATACATCATGG
Strand - +
Off-target summary No data {0: 4, 1: 499, 2: 21891, 3: 13163, 4: 9962}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!