ID: 1138884907_1138884910

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1138884907 1138884910
Species Human (GRCh38) Human (GRCh38)
Location 16:61064874-61064896 16:61064900-61064922
Sequence CCCATAATGATGGACTGGATAAA AATGTGGCTCATATACATCATGG
Strand - +
Off-target summary {0: 2, 1: 25, 2: 687, 3: 18256, 4: 15865} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!