ID: 1138979448_1138979456

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1138979448 1138979456
Species Human (GRCh38) Human (GRCh38)
Location 16:62249420-62249442 16:62249442-62249464
Sequence CCTTGACATGTGAGGATTACAAT TTGGAGGGGAGATTTGGATGGGG
Strand - +
Off-target summary {0: 22, 1: 219, 2: 570, 3: 1188, 4: 2047} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!