ID: 1139116729_1139116731

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1139116729 1139116731
Species Human (GRCh38) Human (GRCh38)
Location 16:63963355-63963377 16:63963371-63963393
Sequence CCATCTAATCAGCTGCCAGTGCA CAGTGCAGCCAGAATAAAGCAGG
Strand - +
Off-target summary {0: 108, 1: 196, 2: 538, 3: 750, 4: 925} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!