ID: 1139451339_1139451345

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1139451339 1139451345
Species Human (GRCh38) Human (GRCh38)
Location 16:67029801-67029823 16:67029821-67029843
Sequence CCGCTCGGAAATCGTAAGTCGGC GGCTGGCCCGGGGCGCGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 4} {0: 1, 1: 0, 2: 3, 3: 59, 4: 450}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!