ID: 1139615380_1139615386

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1139615380 1139615386
Species Human (GRCh38) Human (GRCh38)
Location 16:68085440-68085462 16:68085458-68085480
Sequence CCGACAGTGGAGGCTTAGGCACC GCACCGGTGGCGGGCGGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 115} {0: 1, 1: 0, 2: 4, 3: 20, 4: 330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!