ID: 1139717263_1139717266

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1139717263 1139717266
Species Human (GRCh38) Human (GRCh38)
Location 16:68823490-68823512 16:68823509-68823531
Sequence CCAAGTGACCACCTTAGAGGTCA GTCAGCGTGTGTGACTGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 86} {0: 1, 1: 0, 2: 1, 3: 24, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!