ID: 1139752967_1139752972

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1139752967 1139752972
Species Human (GRCh38) Human (GRCh38)
Location 16:69120295-69120317 16:69120320-69120342
Sequence CCCAGTGGGTGGCCTGTGTTCAG CAGGACCCCCCTGTGGTCCCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 16, 4: 181} {0: 1, 1: 1, 2: 0, 3: 27, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!