ID: 1139752970_1139752981

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1139752970 1139752981
Species Human (GRCh38) Human (GRCh38)
Location 16:69120307-69120329 16:69120343-69120365
Sequence CCTGTGTTCAGAACAGGACCCCC GAACCGTCGAGCCGTCCTCGAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 14, 4: 143} {0: 1, 1: 0, 2: 0, 3: 2, 4: 7}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!