ID: 1139851009_1139851018

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1139851009 1139851018
Species Human (GRCh38) Human (GRCh38)
Location 16:69951632-69951654 16:69951660-69951682
Sequence CCGGGGGCGGTGAGGGGTGGATG CTGGGGAGGAAGGAGGAGGAAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 28, 4: 337} {0: 3, 1: 0, 2: 45, 3: 416, 4: 2798}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!