ID: 1139878386_1139878395

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1139878386 1139878395
Species Human (GRCh38) Human (GRCh38)
Location 16:70164468-70164490 16:70164516-70164538
Sequence CCAAACTCCAACACCTCACATGG ATGAATGGGCAAAAAGTGGAGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 39, 3: 81, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!