ID: 1139962283_1139962290

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1139962283 1139962290
Species Human (GRCh38) Human (GRCh38)
Location 16:70724909-70724931 16:70724944-70724966
Sequence CCATCTGCATTCTGGGTAGGTGG TCTAGCAAACAGACTTAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 344} {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!