ID: 1140152479_1140152484

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1140152479 1140152484
Species Human (GRCh38) Human (GRCh38)
Location 16:72383575-72383597 16:72383618-72383640
Sequence CCAACCCCAATGGTATGATTGGA TGGAAATATTTACAAATATGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 15, 3: 121, 4: 848}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!